paper n a pegfp c3 ar Search Results


93
Addgene inc paper n a pegfp c3 ar
Paper N A Pegfp C3 Ar, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pEGFP(C3)-Nup153-N+(Plasmid+%2364318)/pm37738977-763-56-67
Average 93 stars, based on 1 article reviews
paper n a pegfp c3 ar - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

98
Addgene inc pspax2 addgene
Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/psPAX2+(Plasmid+%2312260)/pm39120973-297-182-183
Average 98 stars, based on 1 article reviews
pspax2 addgene - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

96
Addgene inc fuw m2rtta addgene
Fuw M2rtta Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/FUW-M2rtTA+(Plasmid+%2320342)/pm39120973-297-188-189
Average 96 stars, based on 1 article reviews
fuw m2rtta addgene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

98
Addgene inc paper n a pmd2 g addgene
Paper N A Pmd2 G Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pMD2%2EG+(Plasmid+%2312259)/pm39120973-297-177-180
Average 98 stars, based on 1 article reviews
paper n a pmd2 g addgene - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

93
Addgene inc paper n a pcdh cmv mcherry sars cov2 n protein
Paper N A Pcdh Cmv Mcherry Sars Cov2 N Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/MAC-SARS-CoV-2+N+(Plasmid+%23158370)/pm39120973-298-170-180
Average 93 stars, based on 1 article reviews
paper n a pcdh cmv mcherry sars cov2 n protein - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

86
Jackson Laboratory mice
Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/mice/pm41558486-276-30-31
Average 86 stars, based on 1 article reviews
mice - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
Ribobio co probes for rna fish
Probes For Rna Fish, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/rna+fish+probe/pm35219381-279-42-48
Average 90 stars, based on 1 article reviews
probes for rna fish - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc resource source identifier pegfp c3 cenp ccbd 3xdmrb
Resource Source Identifier Pegfp C3 Cenp Ccbd 3xdmrb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pEGFP(C3)-Nup153+(Plasmid+%2364268)/pm37295434-259-2-15
Average 93 stars, based on 1 article reviews
resource source identifier pegfp c3 cenp ccbd 3xdmrb - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Addgene inc myc bioid2 mcs addgene
Myc Bioid2 Mcs Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/myc-BioID2-MCS+(Plasmid+%2374223)/pm37527040-274-14-15
Average 94 stars, based on 1 article reviews
myc bioid2 mcs addgene - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

96
Addgene inc lenticrisprv2 addgene
Lenticrisprv2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/lentiCRISPR+v2+(Plasmid+%2352961)/pm37527040-275-17-18
Average 96 stars, based on 1 article reviews
lenticrisprv2 addgene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

91
Addgene inc hmyo6 fl d179y pegfp c3 myo6 d179y for ggaacaggtcaagatattt atgacagaattgttgaagc myo6 d179y rev gcttcaacaattctgtcataaatatcttgacc tgttcc
Hmyo6 Fl D179y Pegfp C3 Myo6 D179y For Ggaacaggtcaagatattt Atgacagaattgttgaagc Myo6 D179y Rev Gcttcaacaattctgtcataaatatcttgacc Tgttcc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pEGFP(C3)-Nup153-C+(880-1475)+(Plasmid+%2364317)/pmc05932465__mmc2-220-92-136
Average 91 stars, based on 1 article reviews
hmyo6 fl d179y pegfp c3 myo6 d179y for ggaacaggtcaagatattt atgacagaattgttgaagc myo6 d179y rev gcttcaacaattctgtcataaatatcttgacc tgttcc - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

92
Addgene inc paper n a pmcherry c1 arfgap1 alps
Paper N A Pmcherry C1 Arfgap1 Alps, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/PRPF4%2E069%2E522+(Plasmid+%23137237)/pm38503285-205-25-41
Average 92 stars, based on 1 article reviews
paper n a pmcherry c1 arfgap1 alps - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

Image Search Results