93
|
Addgene inc
paper n a pegfp c3 ar Paper N A Pegfp C3 Ar, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pEGFP(C3)-Nup153-N+(Plasmid+%2364318)/pm37738977-763-56-67 Average 93 stars, based on 1 article reviews
paper n a pegfp c3 ar - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
98
|
Addgene inc
pspax2 addgene Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/psPAX2+(Plasmid+%2312260)/pm39120973-297-182-183 Average 98 stars, based on 1 article reviews
pspax2 addgene - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
96
|
Addgene inc
fuw m2rtta addgene Fuw M2rtta Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/FUW-M2rtTA+(Plasmid+%2320342)/pm39120973-297-188-189 Average 96 stars, based on 1 article reviews
fuw m2rtta addgene - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
98
|
Addgene inc
paper n a pmd2 g addgene Paper N A Pmd2 G Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pMD2%2EG+(Plasmid+%2312259)/pm39120973-297-177-180 Average 98 stars, based on 1 article reviews
paper n a pmd2 g addgene - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
93
|
Addgene inc
paper n a pcdh cmv mcherry sars cov2 n protein Paper N A Pcdh Cmv Mcherry Sars Cov2 N Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/MAC-SARS-CoV-2+N+(Plasmid+%23158370)/pm39120973-298-170-180 Average 93 stars, based on 1 article reviews
paper n a pcdh cmv mcherry sars cov2 n protein - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
86
|
Jackson Laboratory
mice Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/mice/pm41558486-276-30-31 Average 86 stars, based on 1 article reviews
mice - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
90
|
Ribobio co
probes for rna fish Probes For Rna Fish, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/rna+fish+probe/pm35219381-279-42-48 Average 90 stars, based on 1 article reviews
probes for rna fish - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
93
|
Addgene inc
resource source identifier pegfp c3 cenp ccbd 3xdmrb Resource Source Identifier Pegfp C3 Cenp Ccbd 3xdmrb, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pEGFP(C3)-Nup153+(Plasmid+%2364268)/pm37295434-259-2-15 Average 93 stars, based on 1 article reviews
resource source identifier pegfp c3 cenp ccbd 3xdmrb - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
94
|
Addgene inc
myc bioid2 mcs addgene Myc Bioid2 Mcs Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/myc-BioID2-MCS+(Plasmid+%2374223)/pm37527040-274-14-15 Average 94 stars, based on 1 article reviews
myc bioid2 mcs addgene - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
96
|
Addgene inc
lenticrisprv2 addgene Lenticrisprv2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/lentiCRISPR+v2+(Plasmid+%2352961)/pm37527040-275-17-18 Average 96 stars, based on 1 article reviews
lenticrisprv2 addgene - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
91
|
Addgene inc
hmyo6 fl d179y pegfp c3 myo6 d179y for ggaacaggtcaagatattt atgacagaattgttgaagc myo6 d179y rev gcttcaacaattctgtcataaatatcttgacc tgttcc Hmyo6 Fl D179y Pegfp C3 Myo6 D179y For Ggaacaggtcaagatattt Atgacagaattgttgaagc Myo6 D179y Rev Gcttcaacaattctgtcataaatatcttgacc Tgttcc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/pEGFP(C3)-Nup153-C+(880-1475)+(Plasmid+%2364317)/pmc05932465__mmc2-220-92-136 Average 91 stars, based on 1 article reviews
hmyo6 fl d179y pegfp c3 myo6 d179y for ggaacaggtcaagatattt atgacagaattgttgaagc myo6 d179y rev gcttcaacaattctgtcataaatatcttgacc tgttcc - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
92
|
Addgene inc
paper n a pmcherry c1 arfgap1 alps Paper N A Pmcherry C1 Arfgap1 Alps, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+pegfp+c3+ar/PRPF4%2E069%2E522+(Plasmid+%23137237)/pm38503285-205-25-41 Average 92 stars, based on 1 article reviews
paper n a pmcherry c1 arfgap1 alps - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |